rs1871046 chr19:44848680 T>C
- Sequence
gctcgctctccctctctctctctc[T/C]cccctccccctccctgttttcctc
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.93 | 0.10 | 1.74 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, diastolic blood pressure (dbp), late onset alzheimers disease, ldl cholesterol, total cholesterol, triglycerides