rs1871203 chr5:83059567 G>T
- Sequence
agcatgcggtttggtgtgtgtata[G/T]ttatatttaccactaactaccagt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- NFAC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFAC3_HUMAN | -2.45 | 2.39 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, ldl cholesterol change with statins, refractive error, serum creatinine, total cholesterol change with statins