rs1871214 chr7:137967876 T>G
- Sequence
ccccatccacttcctgggacacca[T/G]gtaaatacctaacagccactgttg
- ASB in cell types
- BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 1.30 | 0.13 | 1.00 | -3.36 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP fasting blood glucose, irritible bowel syndrome, tetrology of fallot, waist hip ratio, years of education