rs1871922 chr3:129183756 G>T
- Sequence
gcactgcggctccgtcagcgccgg[G/T]cccctcccccagccctcaccttcc
- ASB in cell types
- tibial nerve brain prefrontal cortex region tissues MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- CTCF_HUMAN ZFX_HUMAN OLIG2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.77 | 1.66 | 1.10 | n/a | No Hit | |||
| ZFX_HUMAN | 0.75 | -0.76 | 1.00 | n/a | No Hit | |||
| OLIG2_HUMAN | -1.30 | 1.59 | 1.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Muscle_Skeletal, Prostate, Skin_Sun_Exposed_Lower_leg, Thyroid