rs1872758 chr10:3702733 G>A
- Sequence
tccagtagacacagagaagcggca[G/A]cataaatattgacatagacaagca
- ASB in cell types
- primary breast cancer primary prostate cancer
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary breast cancer | 2.50 | -0.33 | 2.00 | |||
| primary prostate cancer | -3.93 | 1.97 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, birth weight, celiac disease, hdl cholesterol, irritible bowel syndrome, ldl cholesterol, partial epilepsy