rs1873613 chr12:40158615 T>C
- Sequence
gagaattctcaggaaatatttaaa[T/C]gtcatgatgagcacctctcagttc
- ASB in cell types
- monocyte-derived dendritic cells
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.23 | 0.84 | 1.42 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, bipolar disorder, body mass index (bmi), college completion, eye color, hdl cholesterol change with statins, leprosy, microalbuminuria, triglycerides change with statins, urinary albumin-to-creatinine ratio