rs1873691 chr10:77005035 G>A
- Sequence
gtgtttgctaattttctttcttac[G/A]tagtcacccattgttcccttccca
- ASB in cell types
- foreskin keratinocyte TTC-1240 (Rhabdoid tumor of the kidney) T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -3.66 | 1.47 | 2.50 | |||
| TTC-1240 (Rhabdoid tumor of the kidney) | 2.03 | -1.52 | 1.00 | |||
| T47D (invasive ductal carcinoma) | 0.95 | 0.46 | 1.07 |
Items per page:
1 – 3 of 3