rs1873726 chr12:129565976 G>A
- Sequence
ttaaatatttgtcctcaaatgcac[G/A]tctttttactggtctgtgacaaaa
- ASB in cell types
- MOLT-4 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MOLT-4 (Adult T acute lymphoblastic leukemia) | 1.18 | -0.19 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP barnes akathisia rating scale, college completion, cystatin c in serum, hdl cholesterol, rheumatoid arthritis, combined control dataset, gender differentiated, waist hip ratio