rs1874075 chr10:30748420 T>A
- Sequence
ttgcccggagcataggaaaaaccc[T/A]ttctagtcccagaatgattttcag
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- SMRC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMRC1_HUMAN | -3.42 | 2.39 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, diastolic blood pressure (dbp), height, ldl cholesterol, systolic blood pressure (sbp), total cholesterol