rs1874308 chr12:54560572 A>T
- Sequence
cccagcgtacatgtattggtggcg[A/T]catctcccagccaatcaggaggcg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- ATF7_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ATF7_HUMAN | -2.23 | 2.58 | 1.00 | 3.82 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP diastolic blood pressure (dbp), hdl cholesterol, obesity with early age of onset (age >2), triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Whole_Blood