rs1874443 chr11:10670067 A>G
- Sequence
tttcagttcctactgacataacca[A/G]ttgagatcagcagcaccttgtttt
- ASB in cell types
- breast tumor xenograft HCT-116 (colon carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor xenograft | -3.08 | 2.96 | 1.00 | |||
| HCT-116 (colon carcinoma) | 1.71 | 0.14 | 1.00 |
Items per page:
1 – 2 of 2