rs1875221 chr16:5117290 A>T
- Sequence
gccatattaaaggtgaatgcagca[A/T]tccccacacaggctgcctggaagg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 1.51 | 0.11 | 1.30 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Esophagus_Gastroesophageal_Junction, Heart_Atrial_Appendage, Thyroid