rs1875671 chr18:73136233 A>T
- Sequence
gaatgcaaattaaattaatgcagt[A/T]tttcatttaaaactagctttgttg
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM18505 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | -1.74 | 2.51 | 1.00 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 2.50 | -2.18 | 1.00 |
Items per page:
1 – 2 of 2