rs1875763 chr1:161727208 C>G
- Sequence
ccccagcccagcgccgagaagaac[C/G]atgcaagccgcgcgtgactgggcg
- ASB in cell types
- T47D (invasive ductal carcinoma) K562 (myelogenous leukemia)
- ASB for transcription factors
- HIF1A_HUMAN RFOX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HIF1A_HUMAN | 2.97 | n/a | 1.50 | n/a | No Hit | |||
| RFOX2_HUMAN | -0.78 | 1.75 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Liver, Ovary, Pituitary, Testis