rs1875883 chr15:76345890 C>T
- Sequence
gggtcaaggcgtaagcccaggggc[C/T]ggcaggagctcaggaaggccggtt
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- PATZ1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PATZ1_HUMAN | n/a | 1.92 | 2.00 | -0.66 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Coronary, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood