rs1876453 chr1:207454573 G>A
- Sequence
gcagggggccaaaagcgagacggt[G/A]ggggcagtgctcgacgcgtgtccg
- ASB in cell types
- neural cell
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.21 | 1.13 | 1.17 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Hippocampus, Brain_Putamen_basal_ganglia, Esophagus_Mucosa, Nerve_Tibial, Testis, Thyroid, Whole_Blood