rs1876487 chr2:72887223 A>C
- Sequence
gtcccacttggcacggactgggct[A/C]ccgccacggtttgacttccgccac
- ASB in cell types
- HEK293 (embryonic kidney) bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.50 | 0.79 | 1.15 | |||
| bipolar neuron | 1.64 | -1.11 | 1.00 |
Items per page:
1 – 2 of 2