rs1876518 chr2:65381775 C>T
- Sequence
gtaatatcctctagcaaatgggaa[C/T]tgtgcaattcaacaggttctgcct
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- IKZF1_HUMAN IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | 1.70 | -1.23 | 1.25 | n/a | n/a | |||
| IKZF2_HUMAN | 1.45 | -0.94 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP anti-tnf treatment response in rheumatoid arthritis (by das-28 score change at 3 months), aortic valve calcium, celiac disease, common variable immunodeficiency, rheumatoid arthritis, rheumatoid arthritis and celiac disease, salmonella-induced pyroptosis, sporadic creutzfeldt-jakob disease, triglycerides
PheWAS abnormal findings on exam of gastrointestinal tract/abdominal area, abnormal reflex, acute osteomyelitis, allergic rhinitis, arthropathy nos, arthropathy nos involving multiple sites, atrophic gastritis, bladder neck obstruction, bronchopneumonia and lung abscess, cardiomegaly, chronic bronchitis, colles fracture, complex regional/central pain syndrome, costochondritis, deficiency anemias nos, dental caries, dupuytrens disease, dyschromia and vitiligo, epistaxis or throat hemorrhage, gastroparesis, hemiplegia, hyperbilirubinemia, hypocalcemia, iron metabolism disorder, keloid scar, leukoplakia of oral mucosa, male genital disorders, noninfectious disorders of lymphatic channels, obstructive chronic bronchitis, oral aphthae, osteoarthrosis, generalized, osteochondropathies, other conditions of brain, nos, other disorders of adrenal glands, other disorders of urethra and urinary tract, other dyschromia, pathological, developmental or recurrent dislocation, poisoning by water, mineral, and uric acid metabolism drugs, polymyalgia rheumatica, sleep disorders, stress incontinence, female, toxic erythema, vascular insufficiency of intestine