rs1877672 chr8:22705683 A>G
- Sequence
cacagcttgcatggatgtctagaa[A/G]gagcttggcagagtcgatatcctg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- PAX8_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PAX8_HUMAN | -2.52 | 2.62 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, adiponectin levels, body mass index (bmi), hdl cholesterol, height, kawasaki disease, kawasaki disease (female), kawasaki disease (male), simpson-angus scale, tardive dyskinesia, years of education