rs1877848 chr17:66518425 T>A
- Sequence
taagatattctctgtcttaacttt[T/A]ttcaggaaaaaatatgattttttg
- ASB in cell types
- MSC (mesenchymal stem cells)
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | 3.82 | 0.00 | 1.25 | n/a | No Hit |
Items per page:
1 – 1 of 1