rs189212 chr8:584296 C>T
- Sequence
gatttataatcctttgggtatata[C/T]caagtaatgcaatcactgggtcaa
- ASB in cell types
- WA01 (H1, human embryonic stem cells)
- ASB for transcription factors
- DUX4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| DUX4_HUMAN | 2.04 | -1.05 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Breast_Mammary_Tissue, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Vagina, Whole_Blood