rs192927 chr2:211035701 C>T
- Sequence
aatgcaatcatgtatcagcaaatg[C/T]aattagagatgataggaaagggca
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) PANC1 (pancreatic ductal adenocarcinoma) adrenal gland THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 1.01 | 0.25 | 1.08 | |||
| PANC1 (pancreatic ductal adenocarcinoma) | 1.84 | -1.22 | 2.00 | |||
| adrenal gland | -0.06 | 2.03 | 1.00 | |||
| THP-1 (acute monocytic leukemia) | 0.62 | 1.01 | 1.00 |
Items per page:
1 – 4 of 4