rs196395 chr1:24503673 T>G
- Sequence
gagtgatctgttccaggttgattc[T/G]tctagcttccgtgcaaaatctgat
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.13 | 0.76 | 1.99 | |||
| K562 (myelogenous leukemia) | 0.74 | 0.45 | 1.04 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Esophagus_Gastroesophageal_Junction, Liver, Lung, Muscle_Skeletal, Pituitary, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid