rs197133 chr6:7994139 C>T
- Sequence
caagatgaaaaaaaacaaagaaaa[C/T]gggttacataaactaacgaaccag
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) KMS-11 (Plasma cell myeloma) GM18505 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | -1.82 | 2.07 | 1.00 | |||
| KMS-11 (Plasma cell myeloma) | n/a | 3.30 | 2.00 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | -1.01 | 1.30 | 1.00 |
Items per page:
1 – 3 of 3