rs197374 chr1:111747361 C>T
- Sequence
tctttctcaggttatgcatagtga[C/T]caaaccccgcctggtaactgtagg
- ASB in cell types
- HEK293 (embryonic kidney) hASC (preadipocytes) THP-1 (acute monocytic leukemia) bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.21 | 0.83 | 1.94 | |||
| hASC (preadipocytes) | -0.87 | 1.80 | 1.00 | |||
| THP-1 (acute monocytic leukemia) | 0.20 | 0.97 | 2.09 | |||
| bipolar neuron | 1.24 | -1.17 | 1.00 | |||
| pancreas | 0.09 | 1.52 | 1.11 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), college completion, cystatin c in serum, fasting blood glucose, fasting insulin, homa-ir, ldl cholesterol, lp-pla2 activity, lp-pla2 mass, obesity with early age of onset (age >2), total cholesterol, waist hip ratio, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Esophagus_Mucosa, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Thyroid