rs198853 chr6:26103868 T>C
- Sequence
aaaaaaaaaaaaaaccgcgccaac[T/C]catgttgttttcaatcaggtccgc
- ASB in cell types
- HepG2 (hepatoblastoma) LNCaP (prostate carcinoma) neural cell
- ASB for transcription factors
- TBP_HUMAN FOXA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TBP_HUMAN | -0.03 | 1.56 | 1.11 | n/a | No Hit | |||
| FOXA2_HUMAN | -1.79 | 2.73 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP asthma, bipolar disorder, cystatin c in serum, diastolic blood pressure (dbp), eye color, height, ldl cholesterol, mean corpuscular hemoglobin concentration (mchc), mean corpuscular volume (mcv), rheumatoid arthritis, serum urate, systolic blood pressure (sbp), triglycerides change with statins, uric acid