rs201456 chr7:102097779 C>G
- Sequence
ttgaaaattcttcccgtatcatta[C/G]gtgattgggtctgcctcttgaaag
- ASB in cell types
- CRC107 (colorectal cancer metastatic stem cells)
- ASB for transcription factors
- TF7L2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF7L2_HUMAN | -1.10 | 1.72 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1