rs201623 chr17:10616725 C>A
- Sequence
ggtggcagccttggctctgtaaaa[C/A]ccaggtctgtttttggtgccctgg
- ASB in cell types
- transverse colon MS-1 (Small cell lung carcinoma) WA09 (embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| transverse colon | -0.40 | 1.59 | 1.00 | |||
| MS-1 (Small cell lung carcinoma) | -0.56 | 0.52 | 1.00 | |||
| WA09 (embryonic stem cells) | 1.10 | 0.41 | 1.38 |
Items per page:
1 – 3 of 3