rs2027349 chr1:150067621 A>G
- Sequence
caggccgcaggtgggtggagaata[A/G]cgcccgcgcgtggcagcggcccag
- ASB in cell types
- HEK293 (embryonic kidney) GM19240 (B cells Lymphoblastoid Cell Lines) Peyer's patch GM19193 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN TBX21_HUMAN GLIS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.49 | 2.94 | 1.37 | 2.45 | Concordant | |||
| STAG1_HUMAN | -2.92 | 3.35 | 3.00 | n/a | n/a | |||
| TBX21_HUMAN | -1.58 | 1.88 | 1.00 | n/a | No Hit | |||
| GLIS1_HUMAN | n/a | 2.48 | 2.00 | n/a | No Hit | |||
| PRDM9_HUMAN | -0.03 | 1.84 | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 13
Motif analysis
Genetic associations
GRASP birth weight, chronic kidney disease, obesity with early age of onset (age >2), serum creatinine
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood