rs20541 chr5:132660272 A>G

Sequence
taaagaaactttttcgcgagggac[A/G]gttcaactgaaacttcgaaagcat
ASB in cell types
GM12878 (female B-cells lymphoblastoid cell line)

Color scale

color scale ref
-log10 FDR of Ref (A) ASB
color scale alt
-log10 FDR of Alt (G) ASB

Details

Cell type
Effect size Ref
Effect size Alt
FDR Ref
FDR Alt
Mean BAD
GM12878 (female B-cells lymphoblastoid cell line) 0.57 0.94 0.670.01 1.06
Items per page:
1 – 1 of 1

Motif analysis

No data available

Genetic associations

EMBL-EBI allergic sensitization asthma cutaneous psoriasis hodgkins lymphoma ige levels psoriasis self-reported allergy
GRASP alopecia areata asthma asthma, childhood and later onset asthma, childhood onset asthma, childhood, later and unknown onset, and severe and industrial asthma asthma, childhood, later and unknown onset, and severe asthma atopic dermatitis classical hodgkin lymphoma (ebv-negative) crohns disease eye color homa-ir hypertension (early onset hypertension) ige in plasma irritible bowel syndrome lung function, forced expiratory volume in 1 second (fev1) lung function, forced vital capacity (fvc) lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc) neuroblastoma (brain cancer) nodular sclerosis hodgkin lymphoma (ebv-negative) pediatric asthma psoriasis psoriasis (cutaneous psoriasis) psoriatic arthritis rheumatoid arthritis severe asthma total classical hodgkin lymphoma total serum ige triglycerides type 2 diabetes
ClinVar allergic rhinitis, susceptibility to asthma, susceptibility to
PheWAS abnormal findings on mammogram or breast exam abnormal results of function studies abnormal tumor markers, elevated cea or ca 125 abnormality of red blood cells adverse drug events and drug allergies adverse effects of antibacterials (not penicillins) adverse effects of cardiac rhythm regulators adverse effects of sedatives or other central nervous system depressants and anesthetics agorophobia, social phobia, and panic disorder angina pectoris atherosclerosis of renal artery av block benign neoplasm of thyroid glands chronic ischemic heart disease chronic pharyngitis and nasopharyngitis complications of gastrostomy, colostomy and enterostomy corneal edema dermatomycoses disorders of fluid, electrolyte, and acid-base balance displacement of intervertebral disc disturbance of skin sensation eating disorder elevated blood pressure reading elevated levels of transaminase or lactic acid dehydrogenase fluid overload genital prolapse herpes zoster with nervous system complications hypercoagulable state hypertrophy of female genital organs inflammatory conditions of jaw intervertebral disc disorder with myelopathy intervertebral disc disorders iron metabolism disorder ischemic heart disease malignant neoplasm of renal pelvis multiple myeloma myeloid leukemia nerve root lesions other benign neoplasm of connective and other soft tissue other disorders of the kidney and ureters painful respiration pathological, developmental or recurrent dislocation pituitary hyperfunction pulmonary embolism and infarction respiratory complications scleritis and episcleritis seborheic dermatitis septicemia suicidal ideation or attempt
Finemapping asthma atopic dermatitis psoriasis
GTEx eQTL Artery_Aorta Cells_Cultured_fibroblasts Colon_Sigmoid Esophagus_Mucosa Heart_Left_Ventricle Muscle_Skeletal Skin_Not_Sun_Exposed_Suprapubic Skin_Sun_Exposed_Lower_leg Testis Thyroid

Download