rs205813 chr14:77030276 G>A
- Sequence
gaatggaatgatagctcccaggtt[G/A]ttagggttgtttgagatttcaact
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | n/a | 2.30 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Cortex, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Testis, Whole_Blood