rs206109 chr13:32310367 G>C
- Sequence
agcataccaactaaaaaacggtta[G/C]aaaaacttccaatgtagacaagaa
- ASB in cell types
- ID00014 (lymphoblastoid cell, DiGeorge syndrome) OCI-LY7 (diffuse large B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | -1.66 | 1.94 | 1.00 | |||
| OCI-LY7 (diffuse large B-cell lymphoma) | 1.43 | -0.57 | 1.00 |
Items per page:
1 – 2 of 2