rs206484 chr18:10290988 C>A
- Sequence
acagccctgtatccctaaaatgat[C/A]gtggatggagttcctctcccagcc
- ASB in cell types
- macrophages form periferal blood monocyte-derived macrophages from peripheral blood MDM(monocyte derived macrophages) CD14+ monocytes
- ASB for transcription factors
- TF65_HUMAN RAD51_HUMAN SPI1_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 3.11 | n/a | 3.00 | n/a | No Hit | |||
| RAD51_HUMAN | -2.11 | 2.60 | 1.00 | n/a | n/a | |||
| SPI1_HUMAN | 1.48 | 0.81 | 1.73 | n/a | No Hit | |||
| STAT1_HUMAN | 2.19 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, hip bone mineral density (bmd), major depressive disorder, paternal transmission distortion, stabilized warfarin dose, transmission distortion