rs206844 chr2:31496670 C>T
- Sequence
gcacctggctcggagggtcctacg[C/T]ccacggagtctcgctgattgctag
- ASB in cell types
- MCF10A (breast epithelial cells)
- ASB for transcription factors
- TEAD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TEAD4_HUMAN | 3.27 | -3.41 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Muscle_Skeletal, Prostate, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid