rs2090520 chr2:191539478 T>C
- Sequence
ttcaaattttggtttttgctctgt[T/C]agattctttctgttcagagaacaa
- ASB in cell types
- H929 (plasma cell myeloma) MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | -2.58 | 2.89 | 1.00 | |||
| MS-1 (Small cell lung carcinoma) | 1.14 | -1.14 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, hdl cholesterol change with statins, triglycerides change with statins