rs2091331 chr10:71981948 A>G
- Sequence
ctcagagtgattctcatgcccagc[A/G]gggatgcagcatcactggcctcca
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.86 | 0.13 | 1.30 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), hdl cholesterol, infant head circumference, mitral annular calcium, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Brain_Caudate_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Heart_Left_Ventricle, Minor_Salivary_Gland, Muscle_Skeletal, Pancreas, Testis, Thyroid