rs2092520 chr20:20084057 T>G
- Sequence
gtgcttggttttgcatacctgaag[T/G]gaaagaaaaatctagttgacgccg
- ASB in cell types
- prostate gland ID00014 (lymphoblastoid cell, DiGeorge syndrome)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| prostate gland | 1.67 | -1.44 | 1.00 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | 0.97 | -0.54 | 1.00 |
Items per page:
1 – 2 of 2