rs2093283 chr20:56787775 G>A
- Sequence
tattttggctcagccgttgttttg[G/A]caataagaatgattaaacagatag
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MDA-MB-231 (breast adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.88 | 0.37 | 3.23 | |||
| MDA-MB-231 (breast adenocarcinoma) | 2.30 | 1.13 | 3.00 |
Items per page:
1 – 2 of 2