rs2094453 chr9:109794631 T>C
- Sequence
ttgatttacaaatagagtggccac[T/C]aggtaaaagttgcccatggccagt
- ASB in cell types
- hMADS-3 (adipose-derived stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| hMADS-3 (adipose-derived stem cells) | 2.33 | -0.32 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, hdl cholesterol, hypertension (early onset hypertension), ldl cholesterol, obesity with early age of onset (age >2), sporadic creutzfeldt-jakob disease, tetrology of fallot, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Breast_Mammary_Tissue, Thyroid