rs2094670 chr13:20359580 A>G
- Sequence
tttctccatgagtggagcatgcct[A/G]tgcgcccatccccgcatctcccat
- ASB for transcription factors
- P63_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| P63_HUMAN | -0.38 | 1.77 | 1.00 | 2.04 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), bipolar disorder, height, infant head circumference, irritible bowel syndrome, obesity with early age of onset (age >2), years of education