rs2095055 chr9:75238546 T>G
- Sequence
gtgtacaactgccatctactgaca[T/G]cttttggtatttcactggcatcct
- ASB in cell types
- heart left ventricle T47D (invasive ductal carcinoma) GM18486 (Lymphoblastoid Cell Lines) GM02255 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| heart left ventricle | -2.53 | 2.87 | 1.00 | |||
| T47D (invasive ductal carcinoma) | 1.01 | 0.57 | 1.22 | |||
| GM18486 (Lymphoblastoid Cell Lines) | -0.13 | 1.00 | 1.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | -0.56 | 0.69 | 1.00 |
Items per page:
1 – 4 of 4