rs209969 chr20:54116172 A>C
- Sequence
acctttaactgagttcctgagatt[A/C]aagtttagtcctagtttgaggcta
- ASB in cell types
- adipose
- ASB for transcription factors
- PPARG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PPARG_HUMAN | 2.97 | n/a | 3.00 | -3.94 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
