rs210011 chrX:130108962 C>T
- Sequence
ctgaactccagagagctcccccta[C/T]gctgctcctgtactggatgcactg
- ASB in cell types
- HEK293 (embryonic kidney) GM12890 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- IKZF3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF3_HUMAN | n/a | 2.88 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Spleen, Testis