rs2100431 chr15:60478651 C>A
- Sequence
ccccaggcagactgataaagtgac[C/A]tgcgagaacctaatcaaatttagg
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.73 | 0.09 | 2.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.60 | 0.79 | 1.06 |
Items per page:
1 – 2 of 2