rs2104227 chr10:124601174 A>G
- Sequence
ggtagggggaagtgcactagagtg[A/G]cgtgtgcctggcgtgggaacaggg
- ASB in cell types
- naive IgD+ B cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| naive IgD+ B cells | 2.14 | -1.22 | 2.00 |
Items per page:
1 – 1 of 1