rs2104903 chr9:136631591 T>C
- Sequence
actgttcctggggctgtgctgccc[T/C]cctgtggctgctgacaactccatg
- ASB in cell types
- foreskin keratinocyte neutrophils from periferal blood HeLa Kyoto (cervical adenocarcinoma) thyroid gland
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 1.06 | 2.67 | |||
| neutrophils from periferal blood | 1.48 | -0.86 | 1.50 | |||
| HeLa Kyoto (cervical adenocarcinoma) | 1.50 | 0.04 | 2.00 | |||
| thyroid gland | -0.79 | 0.80 | 1.00 | |||
| THP-1 (acute monocytic leukemia) | 0.96 | 0.62 | 2.00 |
Items per page:
1 – 5 of 10