rs2105267 chr1:84443392 A>G
- Sequence
cttgagcttggcaggcagagaagc[A/G]tctgccattactgaggcttgagta
- ASB in cell types
- breast tumor xenograft
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor xenograft | 2.14 | -1.81 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Minor_Salivary_Gland, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Stomach