rs2106003 chr14:106418055 A>G
- Sequence
tacacagacttgtcttgggctctc[A/G]gttttattatcttaaaagagaatc
- ASB in cell types
- GM18505 (female B-cells Lymphoblastoid Cell Lines) MDA-MB-157 (triple negative breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 2.85 | n/a | 1.50 | |||
| MDA-MB-157 (triple negative breast carcinoma) | 2.29 | -3.76 | 1.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Colon_Transverse, Esophagus_Mucosa, Lung, Small_Intestine_Terminal_Ileum, Spleen, Testis, Whole_Blood