rs2108130 chr7:28922563 C>A
- Sequence
gcattttttagttaccaccatcgc[C/A]aagatagacttttggacaatatta
- ASB in cell types
- ID00014 (lymphoblastoid cell, DiGeorge syndrome) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | n/a | 2.30 | 1.00 | |||
| foreskin keratinocyte | 1.54 | -0.16 | 3.00 |
Items per page:
1 – 2 of 2