rs2108355 chr7:30478861 A>T
- Sequence
gccggctgctgggagaggccgccg[A/T]agggcgggggcggtcaaggcaggg
- ASB in cell types
- PANC1 (pancreatic ductal adenocarcinoma) GM19240 (B cells Lymphoblastoid Cell Lines) GM12890 (Lymphoblastoid Cell Lines) GM02630 (Fanconi anemi)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.42 | 2.06 | 1.19 | -0.04 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
